After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек STRAP Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human STRAP Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC000162
Размер кДНК:1053bp
Описание кДНК:Full length Clone DNA of Homo sapiens serine/threonine kinase receptor associated protein.
Синоним гена:MAWD, PT-WD, UNRIP, STRAP
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек STRAP Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек STRAP Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14218-ACGRBS15400
Человек STRAP Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14218-ACRRBS15400
Человек STRAP Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14218-ANGRBS15400
Человек STRAP Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14218-ANRRBS15400
Человек STRAP Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14218-CFRBS13340
Человек STRAP Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14218-CHRBS13340
Человек STRAP Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14218-CMRBS13340
Человек STRAP Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14218-CYRBS13340
Человек STRAP Джин клон кДНК в вектор клонированияHG14218-GRBS5130
Человек STRAP Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14218-NFRBS13340
Человек STRAP Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14218-NHRBS13340
Человек STRAP Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14218-NMRBS13340
Человек STRAP Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14218-NYRBS13340
Человек STRAP Джин ORF экспрессии кДНК клона плазмидыHG14218-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14218-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».