After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек STOML2 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human STOML2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC014990.1
Размер кДНК:1071bp
Описание кДНК:Full length Clone DNA of Homo sapiens stomatin (EPB72)-like 2.
Синоним гена:SLP-2, HSPC108
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек STOML2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек STOML2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16147-ACGRBS15396
Человек STOML2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16147-ACRRBS15396
Человек STOML2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG16147-ANGRBS15396
Человек STOML2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG16147-ANRRBS15396
Человек STOML2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16147-CFRBS13343
Человек STOML2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16147-CHRBS13343
Человек STOML2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16147-CMRBS13343
Человек STOML2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16147-CYRBS13343
Человек STOML2 Джин клон кДНК в вектор клонированияHG16147-GRBS5132
Человек STOML2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16147-NFRBS13343
Человек STOML2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16147-NHRBS13343
Человек STOML2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16147-NMRBS13343
Человек STOML2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16147-NYRBS13343
Человек STOML2 Джин ORF экспрессии кДНК клона плазмидыHG16147-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG16147-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».