Быстрый заказ

Text Size:AAA

Человек STIP1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human STIP1 Информация о продукте «Клон cDNA»
Размер кДНК:1632bp
Описание кДНК:Full length Clone DNA of Homo sapiens stress-induced phosphoprotein 1 with C terminal HA tag.
Синоним гена:HOP, P60, STI1, STI1L, HEL-S-94n, IEF-SSP-3521
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек STIP1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек STIP1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16371-ACGRBS16760
Человек STIP1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16371-ACRRBS16760
Человек STIP1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG16371-ANGRBS16760
Человек STIP1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG16371-ANRRBS16760
Человек STIP1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16371-CFRBS14710
Человек STIP1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16371-CHRBS14710
Человек STIP1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16371-CMRBS14710
Человек STIP1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16371-CYRBS14710
Человек STIP1 Джин клон кДНК в вектор клонированияHG16371-GRBS5130
Человек STIP1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16371-NFRBS14710
Человек STIP1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16371-NHRBS14710
Человек STIP1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16371-NMRBS14710
Человек STIP1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16371-NYRBS14710
Человек STIP1 Джин ORF экспрессии кДНК клона плазмидыHG16371-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG16371-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.