STIM1 cDNA ORF Clone, Human, N-Myc tag

Price:
Size:
Number:

STIM1 cDNA ORF Clone, Human, N-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2058 bp
Description
Full length Clone DNA of Human stromal interaction molecule 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

STIM1 cDNA ORF Clone, Human, N-Myc tag: Alternative Names

D11S4896E cDNA ORF Clone, Human; GOK cDNA ORF Clone, Human; IMD10 cDNA ORF Clone, Human; STRMK cDNA ORF Clone, Human; TAM cDNA ORF Clone, Human; TAM1 cDNA ORF Clone, Human

STIM1 Background Information

Stromal interaction molecule 1, also known as STIM1 and GOK, is a cell membrane, a single-pass type I membrane protein and a endoplasmic reticulum membrane protein. STIM1 / GOK is ubiquitously expressed in various human primary cells and tumor cell lines. It contains oneEF-hand domain and oneSAM (sterile alpha motif) domain. STIM1 / GOK plays a role in mediating Ca2+influx following depletion of intracellular Ca2+stores. It acts as Ca2+sensor in the endoplasmic reticulum via its EF-hand domain. Upon Ca2+depletion, STIM1 / GOK translocates from the endoplasmic reticulum to the plasma membrane where it activates the Ca2+release-activated Ca2+(CRAC) channel subunit, TMEM142A / ORAI1. Transfection of STIM1 / GOK into cells derived from a rhabdoid tumor and from a rhabdomyosarcoma that do not express detectable levels of STIM1 can induce cell death, suggesting a possible role in the control of rhabdomyosarcomas and rhabdoid tumors. Defects in STIM1 are the cause of immune dysfunction with T-cell inactivation due to calcium entry defect type 2 (IDTICED2) which is an immune disorder characterized by recurrent infections, impaired T-cell activation and proliferative response, decreased T-cell production of cytokines, lymphadenopathy, and normal lymphocytes counts and serum immunoglobulin levels.
Full Name
stromal interaction molecule 1
References
  • Sabbioni S. et al., 1997, Cancer Res. 57: 4493-7.
  • Manji S.S. et al., 2000, Biochim. Biophys. Acta 1481: 147-55.
  • Williams R.T. et al., 2002, Biochim. Biophys. Acta. 1596: 131-7.
  • Spassova M.A. et al., 2006, Proc. Natl. Acad. Sci. USA. 103: 4040-5.
  • Parvez S. et al., 2008, FASEB J. 22: 752-61.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait