Быстрый заказ

Человек STIM1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек STIM1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_003156.3
    Размер кДНК:2058bp
    Описание кДНК:Full length Clone DNA of Homo sapiens stromal interaction molecule 1 with N terminal Myc tag.
    Синоним гена:GOK, D11S4896E, STIM1
    Виды:Human
    переносчик:pCMV3-SP-N-Myc
    Plasmid:
    Участок рестрикции:
    Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with STIM1 qPCR primers for gene expression analysis, HP101311 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Человек STIM1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
    Человек STIM1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11434-ACGRBS16760
    Человек STIM1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11434-ACRRBS16760
    Человек STIM1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11434-CFRBS14710
    Человек STIM1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11434-CHRBS14710
    Человек STIM1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11434-CMRBS14710
    Человек STIM1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11434-CYRBS14710
    Человек STIM1 Gene cDNA clone plasmidHG11434-MRBS5130
    Человек STIM1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11434-M-FRBS14710
    Человек STIM1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11434-NFRBS14710
    Человек STIM1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11434-NHRBS14710
    Человек STIM1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11434-NMRBS14710
    Человек STIM1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11434-NYRBS14710
    Человек STIM1 Джин ORF экспрессии кДНК клона плазмидыHG11434-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    Stromal interaction molecule 1, also known as STIM1 and GOK, is a cell membrane, a single-pass type I  membrane protein and a endoplasmic reticulum membrane protein. STIM1 / GOK is ubiquitously expressed in various human primary cells and tumor cell lines. It contains one EF-hand domain and one SAM (sterile alpha motif) domain. STIM1 / GOK plays a role in mediating Ca2+ influx following depletion of intracellular Ca2+ stores. It acts as Ca2+ sensor in the endoplasmic reticulum via its EF-hand domain. Upon Ca2+ depletion, STIM1 / GOK translocates from the endoplasmic reticulum to the plasma membrane where it activates the Ca2+ release-activated Ca2+ (CRAC) channel subunit, TMEM142A / ORAI1. Transfection of STIM1 / GOK into cells derived from a rhabdoid tumor and from a rhabdomyosarcoma that do not express detectable levels of STIM1 can induce cell death, suggesting a possible role in the control of rhabdomyosarcomas and rhabdoid tumors. Defects in STIM1 are the cause of immune dysfunction with T-cell inactivation due to calcium entry defect type 2 (IDTICED2) which is an immune disorder characterized by recurrent infections, impaired T-cell activation and proliferative response, decreased T-cell production of cytokines, lymphadenopathy, and normal lymphocytes counts and serum immunoglobulin levels.

    Ссылки
  • Sabbioni S. et al., 1997, Cancer Res. 57: 4493-7.
  • Manji S.S. et al., 2000, Biochim. Biophys. Acta 1481: 147-55.
  • Williams R.T. et al., 2002, Biochim. Biophys. Acta. 1596: 131-7.
  • Spassova M.A. et al., 2006, Proc. Natl. Acad. Sci. USA. 103: 4040-5.
  • Parvez S. et al., 2008, FASEB J. 22: 752-61.
  • Size / Price
    Каталог: HG11434-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».