Быстрый заказ

Text Size:AAA

Человек STEAP3 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human STEAP3 Информация о продукте «Клон cDNA»
Размер кДНК:1467bp
Описание кДНК:Full length Clone DNA of Homo sapiens STEAP family member 3, metalloreductase with N terminal His tag.
Синоним гена:STMP3, TSAP6, dudlin-2
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек STEAP3 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек STEAP3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15381-ACGRBS15400
Человек STEAP3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15381-ACRRBS15400
Человек STEAP3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15381-ANGRBS15400
Человек STEAP3 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15381-ANRRBS15400
Человек STEAP3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15381-CFRBS13340
Человек STEAP3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15381-CHRBS13340
Человек STEAP3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15381-CMRBS13340
Человек STEAP3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15381-CYRBS13340
Человек STEAP3 Джин клон кДНК в вектор клонированияHG15381-GRBS5130
Человек STEAP3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15381-NFRBS13340
Человек STEAP3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15381-NHRBS13340
Человек STEAP3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15381-NMRBS13340
Человек STEAP3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15381-NYRBS13340
Человек STEAP3 Джин ORF экспрессии кДНК клона плазмидыHG15381-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15381-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.