Быстрый заказ

Человек STC2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human STC2 Информация о продукте «Клон cDNA»
Размер кДНК:909bp
Описание кДНК:Full length Clone DNA of Homo sapiens stanniocalcin 2 with N terminal His tag.
Синоним гена:STC-2, STCRP, STC2
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек STC2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек STC2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13653-ACGRBS15400
Человек STC2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13653-ACRRBS15400
Человек STC2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13653-CFRBS13340
Человек STC2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13653-CHRBS13340
Человек STC2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13653-CMRBS13340
Человек STC2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13653-CYRBS13340
Человек STC2 Джин клон кДНК в вектор клонированияHG13653-GRBS5130
Человек STC2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13653-NFRBS13340
Человек STC2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13653-NHRBS13340
Человек STC2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13653-NMRBS13340
Человек STC2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13653-NYRBS13340
Человек STC2 Джин ORF экспрессии кДНК клона плазмидыHG13653-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

STC2 is a secreted, homodimeric glycoprotein which expressed in a wide variety of tissues. STC2 has an anti-hypocalcemic action on calcium and phosphate homeostasis. It may have autocrine or paracrine functions. Its C-terminus contains a cluster of histidine residues which may interact with metal ions. STC2 has 10 of its 15 cysteine residues conserved among stanniocalcin family members and is phosphorylated by casein kinase 2 exclusively on its serine residues. It may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis.

  • Chang AC, et al. (1998) Identification of a second stanniocalcin cDNA in mouse and human: stanniocalcin 2. Mol Cell Endocrinol. 141(1-2):95-9.
  • Ishibashi K, et al. (1998) Molecular cloning of a second human stanniocalcin homologue (STC2). Biochem Biophys Res Commun. 250(2):252-8.
  • uo CW, et al. (2005) Identification of a stanniocalcin paralog, stanniocalcin-2, in fish and the paracrine actions of stanniocalcin-2 in the mammalian ovary. Endocrinology. 146(1):469-76.
  • Size / Price
    Каталог: HG13653-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.