After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек ST6GALNAC5 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human ST6GALNAC5 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC001201
Размер кДНК:1011bp
Описание кДНК:Full length Clone DNA of Homo sapiens ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5.
Синоним гена:SIAT7E, ST6GalNAcV, MGC3184, ST6GALNAC5
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек ST6GALNAC5 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек ST6GALNAC5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14225-ACGRBS15400
Человек ST6GALNAC5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14225-ACRRBS15400
Человек ST6GALNAC5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14225-CFRBS13340
Человек ST6GALNAC5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14225-CHRBS13340
Человек ST6GALNAC5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14225-CMRBS13340
Человек ST6GALNAC5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14225-CYRBS13340
Человек ST6GALNAC5 Джин клон кДНК в вектор клонированияHG14225-GRBS5130
Человек ST6GALNAC5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14225-NFRBS13340
Человек ST6GALNAC5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14225-NHRBS13340
Человек ST6GALNAC5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14225-NMRBS13340
Человек ST6GALNAC5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14225-NYRBS13340
Человек ST6GALNAC5 Джин ORF экспрессии кДНК клона плазмидыHG14225-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14225-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».