Быстрый заказ

Text Size:AAA

Человек ST6GALNAC3 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ST6GALNAC3 Информация о продукте «Клон cDNA»
Размер кДНК:918bp
Описание кДНК:Full length Clone DNA of Homo sapiens ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3 with C terminal His tag.
Синоним гена:STY, SIAT7C, PRO7177, ST6GALNACIII
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек ST6GALNAC3 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек ST6GALNAC3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15167-ACGRBS15400
Человек ST6GALNAC3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15167-ACRRBS15400
Человек ST6GALNAC3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15167-CFRBS13340
Человек ST6GALNAC3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15167-CHRBS13340
Человек ST6GALNAC3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15167-CMRBS13340
Человек ST6GALNAC3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15167-CYRBS13340
Человек ST6GALNAC3 Джин клон кДНК в вектор клонированияHG15167-GRBS5130
Человек ST6GALNAC3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15167-NFRBS13340
Человек ST6GALNAC3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15167-NHRBS13340
Человек ST6GALNAC3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15167-NMRBS13340
Человек ST6GALNAC3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15167-NYRBS13340
Человек ST6GALNAC3 Джин ORF экспрессии кДНК клона плазмидыHG15167-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15167-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.