Быстрый заказ

Text Size:AAA

Человек SSSCA1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human SSSCA1 Информация о продукте «Клон cDNA»
Размер кДНК:600bp
Описание кДНК:Full length Clone DNA of Homo sapiens Sjogren syndrome/scleroderma autoantigen 1 with N terminal HA tag.
Синоним гена:p27
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек SSSCA1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек SSSCA1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10521-ACGRBS15400
Человек SSSCA1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10521-ACRRBS15400
Человек SSSCA1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10521-ANGRBS15400
Человек SSSCA1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10521-ANRRBS15400
Человек SSSCA1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10521-CFRBS13340
Человек SSSCA1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10521-CHRBS13340
Человек SSSCA1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10521-CMRBS13340
Человек SSSCA1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10521-CYRBS13340
Человек SSSCA1 Джин клон кДНК в вектор клонированияHG10521-MRBS5130
Человек SSSCA1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10521-M-FRBS13340
Человек SSSCA1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10521-NFRBS13340
Человек SSSCA1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10521-NHRBS13340
Человек SSSCA1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10521-NMRBS13340
Человек SSSCA1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10521-NYRBS13340
Человек SSSCA1 Джин ORF экспрессии кДНК клона плазмидыHG10521-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG10521-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.