Быстрый заказ

Человек SSNA1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human SSNA1 Информация о продукте «Клон cDNA»
Размер кДНК:360bp
Описание кДНК:Full length Clone DNA of Homo sapiens Sjogren syndrome nuclear autoantigen 1 with C terminal His tag.
Синоним гена:N14, NA14, NA-14
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек SSNA1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек SSNA1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16344-ACGRBS15400
Человек SSNA1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16344-ACRRBS15400
Человек SSNA1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG16344-ANGRBS15400
Человек SSNA1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG16344-ANRRBS15400
Человек SSNA1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16344-CFRBS13340
Человек SSNA1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16344-CHRBS13340
Человек SSNA1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16344-CMRBS13340
Человек SSNA1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16344-CYRBS13340
Человек SSNA1 Джин клон кДНК в вектор клонированияHG16344-GRBS5130
Человек SSNA1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16344-NFRBS13340
Человек SSNA1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16344-NHRBS13340
Человек SSNA1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16344-NMRBS13340
Человек SSNA1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16344-NYRBS13340
Человек SSNA1 Джин ORF экспрессии кДНК клона плазмидыHG16344-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG16344-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.