After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек SSNA1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human SSNA1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_003731.2
Размер кДНК:360bp
Описание кДНК:Full length Clone DNA of Homo sapiens Sjogren syndrome nuclear autoantigen 1 with C terminal His tag.
Синоним гена:N14, NA14, NA-14
Виды:Human
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек SSNA1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек SSNA1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16344-ACGRBS15400
Человек SSNA1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16344-ACRRBS15400
Человек SSNA1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG16344-ANGRBS15400
Человек SSNA1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG16344-ANRRBS15400
Человек SSNA1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16344-CFRBS13340
Человек SSNA1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16344-CHRBS13340
Человек SSNA1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16344-CMRBS13340
Человек SSNA1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16344-CYRBS13340
Человек SSNA1 Джин клон кДНК в вектор клонированияHG16344-GRBS5130
Человек SSNA1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16344-NFRBS13340
Человек SSNA1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16344-NHRBS13340
Человек SSNA1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16344-NMRBS13340
Человек SSNA1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16344-NYRBS13340
Человек SSNA1 Джин ORF экспрессии кДНК клона плазмидыHG16344-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG16344-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».