Быстрый заказ

Человек SRY Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Человек SRY Информация о продукте «Клон cDNA»
Размер кДНК:657 bp
Описание кДНК:Full length Clone DNA of Homo sapiens sex determining region Y with C terminal HA tag.
Синоним гена:TDF, TDY, SRY
Участок рестрикции:KpnI + NotI(6kb+0.66kb)
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
( We provide with SRY qPCR primers for gene expression analysis, HP101593 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек SRY Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек SRY Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12062-ACGRBS15400
Человек SRY Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12062-ACRRBS15400
Человек SRY Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12062-ANGRBS15400
Человек SRY Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12062-ANRRBS15400
Человек SRY Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12062-CFRBS13340
Человек SRY Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12062-CHRBS13340
Человек SRY Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12062-CMRBS13340
Человек SRY Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12062-CYRBS13340
Человек SRY Джин клон кДНК в вектор клонированияHG12062-GRBS5130
Человек SRY Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12062-NFRBS13340
Человек SRY Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12062-NHRBS13340
Человек SRY Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12062-NMRBS13340
Человек SRY Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12062-NYRBS13340
Человек SRY Джин ORF экспрессии кДНК клона плазмидыHG12062-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG12062-CY
Цена по прейскуранту: 
Цена:      (You Save: )
НаличиеIn Stock
Добавить в корзинуЗапрос по оптовому заказу
Contact Us
  • Rhesus TLR4 / TLR-4 Gene Plasmid Map 5626
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.