After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек SRP9 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human SRP9 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_003133.5
Размер кДНК:261bp
Описание кДНК:Full length Clone DNA of Homo sapiens signal recognition particle 9kDa.
Синоним гена:ALURBP
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек SRP9 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек SRP9 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16165-ACGRBS15400
Человек SRP9 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16165-ACRRBS15400
Человек SRP9 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG16165-ANGRBS15400
Человек SRP9 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG16165-ANRRBS15400
Человек SRP9 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16165-CFRBS13340
Человек SRP9 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16165-CHRBS13340
Человек SRP9 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16165-CMRBS13340
Человек SRP9 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16165-CYRBS13340
Человек SRP9 Джин клон кДНК в вектор клонированияHG16165-GRBS5130
Человек SRP9 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16165-NFRBS13340
Человек SRP9 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16165-NHRBS13340
Человек SRP9 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16165-NMRBS13340
Человек SRP9 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16165-NYRBS13340
Человек SRP9 Джин ORF экспрессии кДНК клона плазмидыHG16165-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG16165-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».