After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек SRM Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human SRM Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC000309
Размер кДНК:909bp
Описание кДНК:Full length Clone DNA of Homo sapiens spermidine synthase.
Синоним гена:PAPT, SPDSY, SPS1, SRML1, SRM
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек SRM Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек SRM Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14261-ACGRBS15400
Человек SRM Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14261-ACRRBS15400
Человек SRM Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14261-ANGRBS15400
Человек SRM Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14261-ANRRBS15400
Человек SRM Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14261-CFRBS13340
Человек SRM Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14261-CHRBS13340
Человек SRM Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14261-CMRBS13340
Человек SRM Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14261-CYRBS13340
Человек SRM Джин клон кДНК в вектор клонированияHG14261-GRBS5130
Человек SRM Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14261-NFRBS13340
Человек SRM Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14261-NHRBS13340
Человек SRM Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14261-NMRBS13340
Человек SRM Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14261-NYRBS13340
Человек SRM Джин ORF экспрессии кДНК клона плазмидыHG14261-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14261-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».