SRFBP1 cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

SRFBP1 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1290 bp
Description
Full length Clone DNA of Human serum response factor binding protein 1.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

SRFBP1 cDNA ORF Clone, Human, untagged: Alternative Names

BUD22 cDNA ORF Clone, Human; P49 cDNA ORF Clone, Human; p49/STRAP cDNA ORF Clone, Human; Rlb1 cDNA ORF Clone, Human; STRAP cDNA ORF Clone, Human

SRFBP1 Background Information

SRFBP1 contains 7 WD repeats and belongs to the WD repeat STRAP family. SRFBP1 may play a role in the cellular distribution of the SMN complex. The SMN complex plays an essential role in spliceosomal snRNP assembly in the cytoplasm and is required for pre-mRNA splicing in the nucleus. SRFBP1 negatively regulates TGF-beta signaling but positively regulates the PDPK1 kinase activity by enhancing its autophosphorylation and by significantly reducing the association of PDPK1 with 14-3-3 protein. SRFBP1 may be involved in regulating transcriptional activation of cardiac genes during the aging process. It also may play a role in biosynthesis and/or processing of SLC2A4 in adipose cells.
Full Name
serum response factor binding protein 1
References
  • Datta PK, et al. (1999) Identification of STRAP, a novel WD domain protein in transforming growth factor-beta signaling. J Biol Chem. 273(52):34671-4.
  • Datta PK, et al. (1998) Identification of STRAP, a novel WD domain protein in transforming growth factor-beta signaling. J Biol Chem. 273(52):34671-4.
  • Datta PK, et al. (2000) STRAP and Smad7 synergize in the inhibition of transforming growth factor beta signaling. Mol Cell Biol. 20(9):3157-67.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait