After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек SRC/Proto-oncogene c-Src Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human SRC Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_005417.3
Размер кДНК:1611bp
Описание кДНК:Full length Clone DNA of Homo sapiens v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) with N terminal His tag.
Синоним гена:ASV, SRC1, c-SRC, p60-Src, SRC
Виды:Human
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек SRC/Proto-oncogene c-Src Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек SRC/Proto-oncogene c-Src Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10755-ACGRBS16760
Человек SRC/Proto-oncogene c-Src Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10755-ACRRBS16760
Человек SRC/Proto-oncogene c-Src Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10755-ANGRBS16760
Человек SRC/Proto-oncogene c-Src Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10755-ANRRBS16760
Человек SRC/Proto-oncogene c-Src Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10755-CFRBS14710
Человек SRC/Proto-oncogene c-Src Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10755-CHRBS14710
Человек SRC/Proto-oncogene c-Src Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10755-CMRBS14710
Человек SRC/Proto-oncogene c-Src Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10755-CYRBS14710
Человек SRC/Proto-oncogene c-Src Джин клон кДНК в вектор клонированияHG10755-MRBS5130
Человек SRC/Proto-oncogene c-Src Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10755-NFRBS14710
Человек SRC/Proto-oncogene c-Src Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10755-NHRBS14710
Человек SRC/Proto-oncogene c-Src Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10755-NMRBS14710
Человек SRC/Proto-oncogene c-Src Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10755-NYRBS14710
Человек SRC/Proto-oncogene c-Src Джин ORF экспрессии кДНК клона плазмидыHG10755-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Proto-oncogene tyrosine-protein kinase SRC is a hydrophobic protein belonging to the SRC family kinase including nine members that is a family of non-receptor tyrosine kinases. SRC protein may exist in different forms: C-SRC and V-SRC. C-SRC is only activated under certain circumstances where it is required such as growth factor signaling, while V-SRC is a constitutively active as opposed to normal SRC (C-SRC). Thus, V-SRC is an instructive example of an oncogene protein kinase whereas C-SRC is a proto-oncogene protein kinase. Inhibition of SRC with NR2A tyrosine phosphorylation mediated by PSD-95 may contribute to the lithium-induced downregulation of NMDA receptor function and provide neuroprotection against excitotoxicity.

Ссылки
  • Juan Ma. et al., 2003, Neuroscience Letters. 348 (3): 185-189.
  • Czernilofsky AP. et al., 1980, Nature. 287: 198-203.
  • Beischlag TV. et al., 2002, Molecular and cellular biology. 22 (12): 4319-33.
  • Size / Price
    Каталог: HG10755-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».