Быстрый заказ

Человек SRC/Proto-oncogene c-Src Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек SRC Информация о продукте «Клон cDNA»
    Размер кДНК:1611bp
    Описание кДНК:Full length Clone DNA of Homo sapiens v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) with N terminal His tag.
    Синоним гена:ASV, SRC1, c-SRC, p60-Src, SRC
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    ( We provide with SRC qPCR primers for gene expression analysis, HP100685 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Человек SRC/Proto-oncogene c-Src Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Человек SRC/Proto-oncogene c-Src Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10755-ACGRBS16760
    Человек SRC/Proto-oncogene c-Src Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10755-ACRRBS16760
    Человек SRC/Proto-oncogene c-Src Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10755-ANGRBS16760
    Человек SRC/Proto-oncogene c-Src Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10755-ANRRBS16760
    Человек SRC/Proto-oncogene c-Src Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10755-CFRBS14710
    Человек SRC/Proto-oncogene c-Src Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10755-CHRBS14710
    Человек SRC/Proto-oncogene c-Src Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10755-CMRBS14710
    Человек SRC/Proto-oncogene c-Src Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10755-CYRBS14710
    Человек SRC/Proto-oncogene c-Src Джин клон кДНК в вектор клонированияHG10755-MRBS5130
    Человек SRC/Proto-oncogene c-Src Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10755-NFRBS14710
    Человек SRC/Proto-oncogene c-Src Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10755-NHRBS14710
    Человек SRC/Proto-oncogene c-Src Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10755-NMRBS14710
    Человек SRC/Proto-oncogene c-Src Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10755-NYRBS14710
    Человек SRC/Proto-oncogene c-Src Джин ORF экспрессии кДНК клона плазмидыHG10755-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name

    Proto-oncogene tyrosine-protein kinase SRC is a hydrophobic protein belonging to the SRC family kinase including nine members that is a family of non-receptor tyrosine kinases. SRC protein may exist in different forms: C-SRC and V-SRC. C-SRC is only activated under certain circumstances where it is required such as growth factor signaling, while V-SRC is a constitutively active as opposed to normal SRC (C-SRC). Thus, V-SRC is an instructive example of an oncogene protein kinase whereas C-SRC is a proto-oncogene protein kinase. Inhibition of SRC with NR2A tyrosine phosphorylation mediated by PSD-95 may contribute to the lithium-induced downregulation of NMDA receptor function and provide neuroprotection against excitotoxicity.

  • Juan Ma. et al., 2003, Neuroscience Letters. 348 (3): 185-189.
  • Czernilofsky AP. et al., 1980, Nature. 287: 198-203.
  • Beischlag TV. et al., 2002, Molecular and cellular biology. 22 (12): 4319-33.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.