Быстрый заказ

Text Size:AAA

Человек SPN/CD43 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human SPN Информация о продукте «Клон cDNA»
Размер кДНК:1203bp
Описание кДНК:Full length Clone DNA of Homo sapiens sialophorin with N terminal Myc tag.
Синоним гена:LSN, CD43, GPL115, SPN
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек SPN/CD43 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек SPN/CD43 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13108-ACGRBS15400
Человек SPN/CD43 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13108-ACRRBS15400
Человек SPN/CD43 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13108-CFRBS13340
Человек SPN/CD43 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13108-CHRBS13340
Человек SPN/CD43 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13108-CMRBS13340
Человек SPN/CD43 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13108-CYRBS13340
Человек SPN/CD43 Джин клон кДНК в вектор клонированияHG13108-GRBS5130
Человек SPN/CD43 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13108-NFRBS13340
Человек SPN/CD43 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13108-NHRBS13340
Человек SPN/CD43 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13108-NMRBS13340
Человек SPN/CD43 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13108-NYRBS13340
Человек SPN/CD43 Джин ORF экспрессии кДНК клона плазмидыHG13108-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

CD43 is an abundantly expressed molecule on the T-cell surface that shows distinct localization to the migrating T-cell uropod and the distal pole complex (DPC) opposite the immunological synapse via association with the ezrin-radixin-moesin (ERM) family of actin regulatory proteins. CD43 has a 235-amino acid (aa) extracellular domain, a 23-aa transmembrane domain, and a 123-aa cytoplasmic domain, all encoded by a single exon. The intracytoplasmic region of the protein is necessary to transduce signals; it is rich in potentially phosphorylable threonines and serines but lacks tyrosine residues as well as catalytic activity. CD43 engagement on human peripheral blood T cells and monocytes leads to cell activation and proliferation through the generation of second messengers such as diacylglycerol and inositol phosphates, protein kinase C (PKC) activation and Ca2+ mobilization. In addition, CD43 ligation on human T cells induces the association of CD43 with Src family kinases, presumably through the interaction of their Src homology 3 domain with a proline-rich region of the CD43 intracytoplasmic tail. This molecule has been implicated in T cell activation, enhancing T cell response to allogeneic or mitogenic stimulation and CD43-specific signals have been reported to be sufficient to activate T cells in the absence of T cell receptor (TCR) engagement. In summary, CD43 regulates multiple T-cell functions, including T-cell activation, proliferation, apoptosis, and migration.

  • . Layseca-Espinosa E, et al. (2003) Journal of Leukocyte Biology. 74(6): 1083-93.
  • Cannon JL, et al. (2011) Mol Biol Cell. 22(7):954-63.
  • Pallant A,et al. (1989). Proc Natl Acad Sci. 86 (4): 1328–32.
  • Size / Price
    Каталог: HG13108-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.