Быстрый заказ

Человек SPG3A/ATL1 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ATL1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_015915.4
Размер кДНК:1677bp
Описание кДНК:Full length Clone DNA of Homo sapiens atlastin GTPase 1 , transcript variant 1 with N terminal HA tag.
Синоним гена:FSP1, GBP3, SPG3, SPG3A, AD-FSP, atlastin1
Виды:Human
переносчик:pCMV3-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек SPG3A/ATL1 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек SPG3A/ATL1 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10523-ACGRBS16760
Человек SPG3A/ATL1 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10523-ACRRBS16760
Человек SPG3A/ATL1 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10523-ANGRBS16760
Человек SPG3A/ATL1 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10523-ANRRBS16760
Человек SPG3A/ATL1 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10523-CFRBS14710
Человек SPG3A/ATL1 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10523-CHRBS14710
Человек SPG3A/ATL1 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10523-CMRBS14710
Человек SPG3A/ATL1 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10523-CYRBS14710
Человек SPG3A/ATL1 transcript variant 1 Джин клон кДНК в вектор клонированияHG10523-MRBS5130
Человек SPG3A/ATL1 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10523-M-FRBS14710
Человек SPG3A/ATL1 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10523-NFRBS14710
Человек SPG3A/ATL1 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10523-NHRBS14710
Человек SPG3A/ATL1 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10523-NMRBS14710
Человек SPG3A/ATL1 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10523-NYRBS14710
Человек SPG3A/ATL1 transcript variant 1 Джин ORF экспрессии кДНК клона плазмидыHG10523-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Atlastin-1, also known as Spastic paraplegia 3 protein A, Guanine nucleotide-binding protein 3, GTP-binding protein 3, GBP3, ATL1 and SPG3A, is a multi-pass membrane protein which belongs to the GBP family and atlastin subfamily. ATL1 / SPG3A is expressed predominantly in the adult and fetal central nervous system. Expression of ATL1 / SPG3A in adult brain is at least 50-fold higher than in other tissues. ATL1 / SPG3A is detected predominantly in pyramidal neurons in the cerebral cortex and the hippocampus of the brain. ATL1 / SPG3A is also expressed in upper and lower motor neurons (at protein level). A distinguishing feature of ATL1 / SPG3A is its frequent early onset, raising the possibility that developmental abnormalities may be involved in its pathogenesis. Missense SPG3A mutant atlastin-1 proteins have impaired GTPase activity and may act in a dominant-negative, loss-of-function manner by forming mixed oligomers with wild-type atlastin-1. Defects in ATL1 / SPG3A are the cause of spastic paraplegia autosomal dominant type 3 (SPG3), also known as Strumpell-Lorrain syndrome. Spastic paraplegia is a degenerative spinal cord disorder characterized by a slow, gradual, progressive weakness and spasticity of the lower limbs.

Size / Price
Каталог: HG10523-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».