Быстрый заказ

Человек SPG21 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human SPG21 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_016630.3
Размер кДНК:927bp
Описание кДНК:Full length Clone DNA of Homo sapiens spastic paraplegia 21 (autosomal recessive, Mast syndrome), transcript variant 1 with N terminal HA tag.
Синоним гена:MAST, ACP33, GL010, BM-019, MASPARDIN
Виды:Human
переносчик:pCMV3-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек SPG21 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек SPG21 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10522-ACGRBS15400
Человек SPG21 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10522-ACRRBS15400
Человек SPG21 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10522-ANGRBS15400
Человек SPG21 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10522-ANRRBS15400
Человек SPG21 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10522-CFRBS13340
Человек SPG21 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10522-CHRBS13340
Человек SPG21 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10522-CMRBS13340
Человек SPG21 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10522-CYRBS13340
Человек SPG21 transcript variant 1 Джин клон кДНК в вектор клонированияHG10522-MRBS5130
Человек SPG21 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10522-M-FRBS13340
Человек SPG21 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10522-NFRBS13340
Человек SPG21 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10522-NHRBS13340
Человек SPG21 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10522-NMRBS13340
Человек SPG21 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10522-NYRBS13340
Человек SPG21 transcript variant 1 Джин ORF экспрессии кДНК клона плазмидыHG10522-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Spastic paraplegia 21 (SPG21), also known as acid Cluster Protein 33 (ACP33) and Mast syndrome protein, is a member of the AB hydrolase superfamily. Human SPG21 is a 308 amino acid residue protein widely expressed in all tissues, including heart, brain, placenta, lung, liver, skeletal muscle, kidney and pancreas. SPG21 binds to the hydrophobic C-terminal amino acids of CD4 which are involved in repression of T cell activation via the noncatalytic alpha/beta hydrolase fold domain. SPG21 thus is proposed to play a role as a negative regulatory factor in CD4-dependent T-cell activation of CD4. Defects in SPG21 are the cause of spastic paraplegia autosomal recessive type 21, also known as Mast syndrome, a neurodegenerative disorder characterized by a slow, gradual, progressive weakness and spasticity of the lower limbs. Rate of progression and the severity of symptoms are quite variable. SPG21 is also associated with dementia and other central nervous system abnormalities.

Ссылки
  • Zeitlmann L. et al., 2001, J Biol Chem. 276: 9123-32.
  • Simpson M. A. et al., 2003, Am J Hum Genet. 73: 1147-156.
  • Ota T. et al., 2004, Nat. Genet.36: 40-45.
  • Kedmi M. et al., 2007, Physiol Genomics. 28: 213-22.
  • Hanna M. C. et al., 2009, Neurogenetics.10: 217-28.
  • Size / Price
    Каталог: HG10522-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».