Быстрый заказ

Text Size:AAA

Человек SPATA24 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human SPATA24 Информация о продукте «Клон cDNA»
Размер кДНК:567bp
Описание кДНК:Full length Clone DNA of Homo sapiens spermatogenesis associated 24 with C terminal His tag.
Синоним гена:T6441, CCDC161
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек SPATA24 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек SPATA24 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15150-ACGRBS15396
Человек SPATA24 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15150-ACRRBS15400
Человек SPATA24 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15150-ANGRBS15396
Человек SPATA24 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15150-ANRRBS15400
Человек SPATA24 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15150-CFRBS13343
Человек SPATA24 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15150-CHRBS13343
Человек SPATA24 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15150-CMRBS13343
Человек SPATA24 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15150-CYRBS13343
Человек SPATA24 Джин клон кДНК в вектор клонированияHG15150-GRBS5132
Человек SPATA24 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15150-NFRBS13343
Человек SPATA24 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15150-NHRBS13343
Человек SPATA24 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15150-NMRBS13343
Человек SPATA24 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15150-NYRBS13343
Человек SPATA24 Джин ORF экспрессии кДНК клона плазмидыHG15150-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15150-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.