After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек SP3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human SP3 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC126414
Размер кДНК:2346bp
Описание кДНК:Full length Clone DNA of Homo sapiens Sp3 transcription factor with N terminal Flag tag.
Синоним гена:SPR2
Виды:Human
переносчик:pCMV3-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек SP3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек SP3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13964-ACGRBS16764
Человек SP3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13964-ACRRBS16764
Человек SP3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG13964-ANGRBS16764
Человек SP3 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG13964-ANRRBS16764
Человек SP3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13964-CFRBS14711
Человек SP3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13964-CHRBS14711
Человек SP3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13964-CMRBS14711
Человек SP3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13964-CYRBS14711
Человек SP3 Джин клон кДНК в вектор клонированияHG13964-GRBS5132
Человек SP3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13964-NFRBS14711
Человек SP3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13964-NHRBS14711
Человек SP3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13964-NMRBS14711
Человек SP3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13964-NYRBS14711
Человек SP3 Джин ORF экспрессии кДНК клона плазмидыHG13964-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13964-NF
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».