After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек SP1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human SP1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_138473.2
Размер кДНК:2358bp
Описание кДНК:Full length Clone DNA of Homo sapiens Sp1 transcription factor.
Синоним гена:SP1
Виды:Human
переносчик:pCMV3-untagged
Plasmid:pCMV3-SP1-t1
Участок рестрикции:HindIII + XbaI (6.1kb + 2.36kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human SP1 Gene Plasmid Map
Human SP1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Человек SP1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек SP1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12024-ACGRBS16764
Человек SP1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12024-ACRRBS16764
Человек SP1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12024-ANGRBS16764
Человек SP1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12024-ANRRBS16764
Человек SP1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12024-CFRBS14711
Человек SP1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12024-CHRBS14711
Человек SP1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12024-CMRBS14711
Человек SP1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12024-CYRBS14711
Человек SP1 Джин клон кДНК в вектор клонированияHG12024-GRBS5132
Человек SP1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12024-NFRBS14711
Человек SP1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12024-NHRBS14711
Человек SP1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12024-NMRBS14711
Человек SP1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12024-NYRBS14711
Человек SP1 Джин ORF экспрессии кДНК клона плазмидыHG12024-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG12024-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
  • Human SP1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».