SOD2 cDNA ORF Clone, Human, C-HA tag

1/1
Price:
Size:
Number:

SOD2 cDNA ORF Clone, Human, C-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
669 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human superoxide dismutase 2, mitochondrial with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI (6kb + 0.71kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

SOD2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SOD2 cDNA ORF Clone, Human, C-HA tag: Validated Images

SOD2 cDNA ORF Clone, Human, C-HA tag: Alternative Names

IPOB cDNA ORF Clone, Human; MNSOD cDNA ORF Clone, Human; MVCD6 cDNA ORF Clone, Human

SOD2 Background Information

Superoxide dismutases (SOD) are important anti-oxidant enzymes that guard against superoxide toxicity. In humans, as in all mammals and most chordates, three forms of superoxide dismutase (SOD) are present: SOD1 is located in the cytoplasm, SOD2 in the mitochondria, and SOD3 is extracellular. Mitochondrial superoxide dismutase [SOD; manganese SOD (MnSOD) or SOD2] neutralizes highly reactive superoxide radical (O(
Full Name
superoxide dismutase 2, mitochondrial
References
  • Culotta VC, et al. (2006) Activation of superoxide dismutases: putting the metal to the pedal. Biochim Biophys Acta. 1763(7): 747-58.
  • Bag A, et al. (2008) Target sequence polymorphism of human manganese superoxide dismutase gene and its association with cancer risk: a review. Cancer Epidemiol Biomarkers Prev. 17(12): 3298-305.
  • Diehl C, et al. (2009) The basis of topical superoxide dismutase antipruritic activity. Acta Dermatovenerol Croat. 17(1): 25-39.
  • Ma X, et al. (2010) No association between SOD2 Val16Ala polymorphism and breast cancer susceptibility: a meta-analysis based on 9,710 cases and 11,041 controls. Breast Cancer Res Treat. 122(2): 509-14.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait