After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек SOD2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human SOD2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_000636
Размер кДНК:669bp
Описание кДНК:Full length Clone DNA of Homo sapiens superoxide dismutase 2, mitochondrial with N terminal Flag tag.
Синоним гена:SOD2
Виды:Human
переносчик:pCMV3-N-FLAG
Plasmid:pCMV3-Flag-SOD2
Участок рестрикции:KpnI + XbaI (6kb + 0.71kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human SOD2 Gene Plasmid Map
Human SOD2 natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек SOD2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек SOD2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12061-ACGRBS15400
Человек SOD2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12061-ACRRBS15400
Человек SOD2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12061-ANGRBS15400
Человек SOD2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12061-ANRRBS15400
Человек SOD2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12061-CFRBS13340
Человек SOD2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12061-CHRBS13340
Человек SOD2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12061-CMRBS13340
Человек SOD2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12061-CYRBS13340
Человек SOD2 Джин клон кДНК в вектор клонированияHG12061-GRBS5130
Человек SOD2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12061-NFRBS13340
Человек SOD2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12061-NHRBS13340
Человек SOD2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12061-NMRBS13340
Человек SOD2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12061-NYRBS13340
Человек SOD2 Джин ORF экспрессии кДНК клона плазмидыHG12061-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Superoxide dismutases (SOD) are important anti-oxidant enzymes that guard against superoxide toxicity. In humans, as in all mammals and most chordates, three forms of superoxide dismutase (SOD) are present: SOD1 is located in the cytoplasm, SOD2 in the mitochondria, and SOD3 is extracellular. Mitochondrial superoxide dismutase [SOD; manganese SOD (MnSOD) or SOD2] neutralizes highly reactive superoxide radical (O(

Ссылки
  • Culotta VC, et al. (2006) Activation of superoxide dismutases: putting the metal to the pedal. Biochim Biophys Acta. 1763(7): 747-58.
  • Bag A, et al. (2008) Target sequence polymorphism of human manganese superoxide dismutase gene and its association with cancer risk: a review. Cancer Epidemiol Biomarkers Prev. 17(12): 3298-305.
  • Diehl C, et al. (2009) The basis of topical superoxide dismutase antipruritic activity. Acta Dermatovenerol Croat. 17(1): 25-39.
  • Ma X, et al. (2010) No association between SOD2 Val16Ala polymorphism and breast cancer susceptibility: a meta-analysis based on 9,710 cases and 11,041 controls. Breast Cancer Res Treat. 122(2): 509-14.
  • Size / Price
    Каталог: HG12061-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
    • Human SOD2 natural ORF mammalian expression plasmid, N-Flag tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».