After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек SNX32 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human SNX32 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC040981
Размер кДНК:1212bp
Описание кДНК:Full length Clone DNA of Homo sapiens sorting nexin 32 with C terminal HA tag.
Синоним гена:SNX6B
Виды:Human
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек SNX32 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек SNX32 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15176-ACGRBS15400
Человек SNX32 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15176-ACRRBS15400
Человек SNX32 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15176-ANGRBS15400
Человек SNX32 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15176-ANRRBS15400
Человек SNX32 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15176-CFRBS13340
Человек SNX32 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15176-CHRBS13340
Человек SNX32 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15176-CMRBS13340
Человек SNX32 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15176-CYRBS13340
Человек SNX32 Джин клон кДНК в вектор клонированияHG15176-GRBS5130
Человек SNX32 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15176-NFRBS13340
Человек SNX32 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15176-NHRBS13340
Человек SNX32 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15176-NMRBS13340
Человек SNX32 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15176-NYRBS13340
Человек SNX32 Джин ORF экспрессии кДНК клона плазмидыHG15176-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15176-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».