Быстрый заказ

Человек SNCB Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Человек SNCB Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001001502.1
Размер кДНК:405bp
Описание кДНК:Full length Clone DNA of Homo sapiens synuclein, beta with N terminal His tag.
Синоним гена:SNCB
Виды:Human
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with SNCB qPCR primers for gene expression analysis, HP101264 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек SNCB Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек SNCB Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11386-ACGRBS15400
Человек SNCB Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11386-ACRRBS15400
Человек SNCB Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11386-ANGRBS15400
Человек SNCB Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11386-ANRRBS15400
Человек SNCB Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11386-CFRBS13340
Человек SNCB Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11386-CHRBS13340
Человек SNCB Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11386-CMRBS13340
Человек SNCB Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11386-CYRBS13340
Человек SNCB Джин клон кДНК в вектор клонированияHG11386-MRBS5130
Человек SNCB Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11386-M-FRBS13340
Человек SNCB Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11386-NFRBS13340
Человек SNCB Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11386-NHRBS13340
Человек SNCB Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11386-NMRBS13340
Человек SNCB Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11386-NYRBS13340
Человек SNCB Джин ORF экспрессии кДНК клона плазмидыHG11386-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG11386-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».