After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек SNAI2 / Snail2 / slug Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human SNAI2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_003068.3
Размер кДНК:807bp
Описание кДНК:Full length Clone DNA of Homo sapiens snail homolog 2 (Drosophila).
Синоним гена:SLUG, WS2D, SLUGH1, MGC10182, SNAI2
Виды:Human
переносчик:pCMV3-untagged
Plasmid:pCMV3-SNAI2
Участок рестрикции:KpnI + NotI (6.1kb + 0.81kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human SNAI2 Gene Plasmid Map
Human SNAI2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Человек SNAI2 / Snail2 / slug Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек SNAI2 / Snail2 / slug Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11196-ACGRBS15400
Человек SNAI2 / Snail2 / slug Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11196-ACRRBS15400
Человек SNAI2 / Snail2 / slug Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11196-ANGRBS15400
Человек SNAI2 / Snail2 / slug Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11196-ANRRBS15400
Человек SNAI2 / Snail2 / slug Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11196-CFRBS13340
Человек SNAI2 / Snail2 / slug Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11196-CHRBS13340
Человек SNAI2 / Snail2 / slug Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11196-CMRBS13340
Человек SNAI2 / Snail2 / slug Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11196-CYRBS13340
Человек SNAI2 / Snail2 / slug Джин клон кДНК в вектор клонированияHG11196-MRBS5130
Человек SNAI2 / Snail2 / slug Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11196-M-FRBS13340
Человек SNAI2 / Snail2 / slug Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11196-NFRBS13340
Человек SNAI2 / Snail2 / slug Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11196-NHRBS13340
Человек SNAI2 / Snail2 / slug Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11196-NMRBS13340
Человек SNAI2 / Snail2 / slug Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11196-NYRBS13340
Человек SNAI2 / Snail2 / slug Джин ORF экспрессии кДНК клона плазмидыHG11196-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG11196-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
  • Human SNAI2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».