Быстрый заказ

Text Size:AAA

Человек SMYD3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human SMYD3 Информация о продукте «Клон cDNA»
Размер кДНК:1110bp
Описание кДНК:Full length Clone DNA of Homo sapiens SET and MYND domain containing 3 transcript variant 2 with N terminal Flag tag.
Синоним гена:RIZ, KMT8, RIZ1, RIZ2, MTB-ZF, HUMHOXY1, PRDM2
Участок рестрикции:KpnI + XbaI (6kb + 1.15kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human SMYD3 Gene Plasmid Map
Human SMYD3 transcript variant 2 natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек SMYD3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек SMYD3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11217-ACGRBS15400
Человек SMYD3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11217-ACRRBS15400
Человек SMYD3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11217-ANGRBS15400
Человек SMYD3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11217-ANRRBS15400
Человек SMYD3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11217-CFRBS13340
Человек SMYD3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11217-CHRBS13340
Человек SMYD3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11217-CMRBS13340
Человек SMYD3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11217-CYRBS13340
Человек SMYD3 transcript variant 2 Джин клон кДНК в вектор клонированияHG11217-MRBS5130
Человек SMYD3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11217-NFRBS13340
Человек SMYD3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11217-NHRBS13340
Человек SMYD3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11217-NMRBS13340
Человек SMYD3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11217-NYRBS13340
Человек SMYD3 transcript variant 2 Джин ORF экспрессии кДНК клона плазмидыHG11217-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

SET and MYND domain-containing protein 3, also known as Zinc finger MYND domain-containing protein 1, SMYD3, and ZMYND, is a member of the histone-lysine methyltransferase family. SMYD3 contains one MYND-type zinc finger and one SET domain. SMYD3 is a histone H3 lysine-4-specific methyltransferase. It is expressed in skeletal muscles and testis. It is overexpressed in a majority of colorectal carcinoma (CRC) and hepatocellular carcinoma (HCC). SMYD3 plays an important role in transcriptional regulation in human carcinogenesis. It activates the transcription of a set of downstream genes. Of these downstream genes, there are several oncogenes and genes associated with cell adhesion (including those of N-Myc, CrkL, Wnt10b, L-selectin, CD31 and galectin-4), which have been shown to have effects on cell viability, adhesion, migration and metastasis. Increased SMYD3 expression is essential for the proliferation of breast cancer cells. SMYD3 may be a promising new target of therapeutic intervention for the treatment of cancers or other pathological processes associated with cell adhesion and migration.

  • Hamamoto, R. et al., 2006, Cancer Sci. 97 (2): 113-8.
  • Luo, XG. et al., 2007, J Biosci Bioeng. 103 (5): 444-50.
  • Wang, XQ. et al., 2007, Exp Oncol. 29 (1): 71-3.
  • Silva, FP. et al., 2008, Oncogene. 27 (19): 2686-92.
  • Size / Price
    Каталог: HG11217-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.