Быстрый заказ

Человек SMYD3 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

  • Human aFGF/FGF1 Gene Plasmid Map 5637
ПаспортОбзорыСвязанные продуктыПротоколы
Человек SMYD3 Информация о продукте «Клон cDNA»
Размер кДНК:1287bp
Описание кДНК:Full length Clone DNA of Homo sapiens SET and MYND domain containing 3 transcript variant 1 with N terminal Flag tag.
Синоним гена:KMT3E, ZMYND1, ZNFN3A1, FLJ21080, MGC104324, bA74P14.1, SMYD3
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
( We provide with SMYD3 qPCR primers for gene expression analysis, HP101118 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек SMYD3 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек SMYD3 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11230-ACGRBS15400
Человек SMYD3 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11230-ACRRBS15400
Человек SMYD3 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11230-ANGRBS15400
Человек SMYD3 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11230-ANRRBS15400
Человек SMYD3 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11230-CFRBS5130
Человек SMYD3 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11230-CHRBS13340
Человек SMYD3 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11230-CMRBS13340
Человек SMYD3 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11230-CYRBS13340
Человек SMYD3 transcript variant 1 Джин клон кДНК в вектор клонированияHG11230-GRBS5130
Человек SMYD3 transcript variant 1 Джин клон кДНК в вектор клонированияHG11230-MRBS5130
Человек SMYD3 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11230-NFRBS13340
Человек SMYD3 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11230-NHRBS13340
Человек SMYD3 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11230-NMRBS13340
Человек SMYD3 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11230-NYRBS13340
Человек SMYD3 transcript variant 1 Джин ORF экспрессии кДНК клона плазмидыHG11230-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

SET and MYND domain-containing protein 3, also known as Zinc finger MYND domain-containing protein 1, SMYD3, and ZMYND, is a member of the histone-lysine methyltransferase family. SMYD3 contains one MYND-type zinc finger and one SET domain. SMYD3 is a histone H3 lysine-4-specific methyltransferase. It is expressed in skeletal muscles and testis. It is overexpressed in a majority of colorectal carcinoma (CRC) and hepatocellular carcinoma (HCC). SMYD3 plays an important role in transcriptional regulation in human carcinogenesis. It activates the transcription of a set of downstream genes. Of these downstream genes, there are several oncogenes and genes associated with cell adhesion (including those of N-Myc, CrkL, Wnt10b, L-selectin, CD31 and galectin-4), which have been shown to have effects on cell viability, adhesion, migration and metastasis. Increased SMYD3 expression is essential for the proliferation of breast cancer cells. SMYD3 may be a promising new target of therapeutic intervention for the treatment of cancers or other pathological processes associated with cell adhesion and migration.

  • Hamamoto, R. et al., 2006, Cancer Sci. 97 (2): 113-8.
  • Luo, XG. et al., 2007, J Biosci Bioeng. 103 (5): 444-50.
  • Wang, XQ. et al., 2007, Exp Oncol. 29 (1): 71-3.
  • Silva, FP. et al., 2008, Oncogene. 27 (19): 2686-92.
  • Size / Price
    Каталог: HG11230-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.