SMURF2 cDNA ORF Clone, Human, N-Myc tag

Price:
Size:
Number:

SMURF2 cDNA ORF Clone, Human, N-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2247 bp
Description
Full length Clone DNA of Human SMAD specific E3 ubiquitin protein ligase 2 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

SMURF2 Background Information

Loss of SMURF2 either by small interfering RNA/short hairpin RNA (siRNA/shRNA) or by overexpression of a catalytically inactive mutant causes KRAS degradation, whereas overexpression of wild-type SMURF2 enhances KRAS stability. silencing SMURF2 (SMAD specific E3 ubiquitin protein ligase 2) promoted EMT in HPDE6c7 normal pancreas cells and overexpression of SMURF2 inhibited TGF-beta-mediated EMT in the cells.
Full Name
SMAD specific E3 ubiquitin protein ligase 2
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait