Быстрый заказ

Человек SMURF2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек SMURF2 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_022739.3
    Размер кДНК:2247bp
    Описание кДНК:Full length Clone DNA of Homo sapiens SMAD specific E3 ubiquitin protein ligase 2 with N terminal Myc tag.
    Синоним гена:MGC138150, DKFZp686F0270, SMURF2
    Виды:Human
    переносчик:pCMV3-SP-N-Myc
    Plasmid:
    Участок рестрикции:
    Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with SMURF2 qPCR primers for gene expression analysis, HP101313 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Человек SMURF2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
    Человек SMURF2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11436-ACGRBS16760
    Человек SMURF2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11436-ACRRBS16760
    Человек SMURF2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11436-ANGRBS16760
    Человек SMURF2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11436-CFRBS14710
    Человек SMURF2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11436-CHRBS14710
    Человек SMURF2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11436-CMRBS14710
    Человек SMURF2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11436-CYRBS14710
    Человек SMURF2 Gene cDNA clone plasmidHG11436-MRBS5130
    Человек SMURF2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11436-NFRBS14710
    Человек SMURF2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11436-NHRBS14710
    Человек SMURF2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11436-NMRBS14710
    Человек SMURF2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11436-NYRBS14710
    Человек SMURF2 Джин ORF экспрессии кДНК клона плазмидыHG11436-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».