Быстрый заказ

Человек SMR3B Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human SMR3B Информация о продукте «Клон cDNA»
Размер кДНК:240bp
Описание кДНК:Full length Clone DNA of Homo sapiens submaxillary gland androgen regulated protein 3B with C terminal HA tag.
Синоним гена:P-B, PBII, PRL3, PROL3, SMR1B, SMR3B
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек SMR3B Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек SMR3B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13442-ACGRBS15400
Человек SMR3B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13442-ACRRBS15400
Человек SMR3B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13442-CFRBS13340
Человек SMR3B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13442-CHRBS13340
Человек SMR3B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13442-CMRBS13340
Человек SMR3B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13442-CYRBS13340
Человек SMR3B Джин клон кДНК в вектор клонированияHG13442-GRBS5130
Человек SMR3B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13442-NFRBS13340
Человек SMR3B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13442-NHRBS13340
Человек SMR3B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13442-NMRBS13340
Человек SMR3B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13442-NYRBS13340
Человек SMR3B Джин ORF экспрессии кДНК клона плазмидыHG13442-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13442-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.