After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек ASM3A / SMPDL3A Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human SMPDL3A Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC018999
Размер кДНК:1362bp
Описание кДНК:Full length Clone DNA of Homo sapiens sphingomyelin phosphodiesterase, acid-like 3A with C terminal Myc tag.
Синоним гена:ASM3A, ASML3a, yR36GH4.1, SMPDL3A
Виды:Human
переносчик:pCMV3-C-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек ASM3A / SMPDL3A Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Человек ASM3A / SMPDL3A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13559-ACGRBS15400
Человек ASM3A / SMPDL3A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13559-ACRRBS15400
Человек ASM3A / SMPDL3A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13559-CFRBS13340
Человек ASM3A / SMPDL3A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13559-CHRBS13340
Человек ASM3A / SMPDL3A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13559-CMRBS13340
Человек ASM3A / SMPDL3A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13559-CYRBS13340
Человек ASM3A / SMPDL3A Джин клон кДНК в вектор клонированияHG13559-GRBS5130
Человек ASM3A / SMPDL3A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13559-NFRBS13340
Человек ASM3A / SMPDL3A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13559-NHRBS13340
Человек ASM3A / SMPDL3A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13559-NMRBS13340
Человек ASM3A / SMPDL3A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13559-NYRBS13340
Человек ASM3A / SMPDL3A Джин ORF экспрессии кДНК клона плазмидыHG13559-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

SMPDL3A gene is a novel liver X receptor (LXR) -regulated gene, with an LXR response element within its promoter. The induction of SMPDL3A is LXR-dependent and is restricted to human blood cells with no induction observed in mouse cellular systems. LXR α and LXRβ function as physiological sensors of cholesterol metabolites (oxysterols), regulating key genes involved in cholesterol and lipid metabolism. LXRs have been extensively studied in both human and rodent cell systems, revealing their potential therapeutic value in the contexts of atherosclerosis and inflammatory diseases. The LXR genome landscape has been investigated in murine macrophages but not in human THP-1 cells, which represent one of the frequently used monocyte/macrophage cell systems to study immune responses.

Ссылки
  • Wright KO, et al. (2002) Increased expression of the acid sphingomyelinase-like protein ASML3a in bladder tumors. J Urol. 168(6):2645-9.
  • Strausberg RL, et al. (2002) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Mungall AJ, et al. (2003) The DNA sequence and analysis of human chromosome 6. Nature. 425(6960):805-11.
  • Size / Price
    Каталог: HG13559-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».