SMOC2 cDNA ORF Clone, Human, N-His tag

Cat: HG12012-NH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All SMOC2 Reagents

CRO Services

Product recommended


All SMOC2 Reagents

SMOC2 cDNA ORF Clone, Human, N-His tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1374 bp
Description
Full length Clone DNA of Human SPARC related modular calcium binding 2 with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SMOC2 cDNA ORF Clone, Human, N-His tag Alternative Names

bA270C4A.1 cDNA ORF Clone, Human;bA37D8.1 cDNA ORF Clone, Human;dJ421D16.1 cDNA ORF Clone, Human;DTDP1 cDNA ORF Clone, Human;MST117 cDNA ORF Clone, Human;MSTP117 cDNA ORF Clone, Human;MSTP140 cDNA ORF Clone, Human;SMAP2 cDNA ORF Clone, Human

SMOC2 Background Information

Full Name
SPARC related modular calcium binding 2

SMOC2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SMOC2 cDNA ORF Clone in Cloning Vector, Rat RG80834-U
SMOC2 cDNA ORF Clone, Rat, untagged RG80834-UT
SMOC2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80834-ACGLN
SMOC2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80834-ACG
SMOC2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80834-ACR
SMOC2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80834-CF
SMOC2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80834-NF
SMOC2 cDNA ORF Clone, Rat, C-His tag RG80834-CH
SMOC2 cDNA ORF Clone, Rat, N-His tag RG80834-NH
SMOC2 cDNA ORF Clone, Rat, C-HA tag RG80834-CY
SMOC2 cDNA ORF Clone, Rat, N-HA tag RG80834-NY
SMOC2 cDNA ORF Clone, Rat, C-Myc tag RG80834-CM
SMOC2 cDNA ORF Clone, Rat, N-Myc tag RG80834-NM
SMOC2 qPCR Primer Pairs, Rat RP300798

SMOC2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SMOC2 cDNA ORF Clone in Cloning Vector, Mouse MG5A0991-U
SMOC2 cDNA ORF Clone, Mouse, untagged MG5A0991-UT
SMOC2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0991-ACGLN
SMOC2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0991-ACG
SMOC2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A0991-ACR
SMOC2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A0991-CF
SMOC2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A0991-NF
SMOC2 cDNA ORF Clone, Mouse, C-His tag MG5A0991-CH
SMOC2 cDNA ORF Clone, Mouse, N-His tag MG5A0991-NH
SMOC2 cDNA ORF Clone, Mouse, C-HA tag MG5A0991-CY
SMOC2 cDNA ORF Clone, Mouse, N-HA tag MG5A0991-NY
SMOC2 cDNA ORF Clone, Mouse, C-Myc tag MG5A0991-CM
SMOC2 cDNA ORF Clone, Mouse, N-Myc tag MG5A0991-NM

SMOC2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SMOC2 cDNA ORF Clone in Cloning Vector, Human HG12012-G
SMOC2 cDNA ORF Clone, Human, untagged HG12012-UT
SMOC2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12012-ACGLN
SMOC2 cDNA ORF Clone, Human, C-GFPSpark® tag HG12012-ACG
SMOC2 cDNA ORF Clone, Human, C-OFPSpark® tag HG12012-ACR
SMOC2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12012-G-F
SMOC2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12012-CF
SMOC2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12012-NF
SMOC2 cDNA ORF Clone, Human, C-His tag HG12012-CH
SMOC2 cDNA ORF Clone, Human, C-HA tag HG12012-CY
SMOC2 cDNA ORF Clone, Human, N-HA tag HG12012-NY
SMOC2 cDNA ORF Clone, Human, C-Myc tag HG12012-CM
SMOC2 cDNA ORF Clone, Human, N-Myc tag HG12012-NM
SMOC2 qPCR Primer Pairs, Human HP101671
info info
添加购物车成功! 添加购物车失败!