After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек SMOC-1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human SMOC1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001034852.1
Размер кДНК:1308bp
Описание кДНК:Full length Clone DNA of Homo sapiens SPARC related modular calcium binding 1.
Синоним гена:SMOC1
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек SMOC-1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек SMOC-1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12026-ACGRBS15400
Человек SMOC-1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12026-ACRRBS15400
Человек SMOC-1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12026-CFRBS13340
Человек SMOC-1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12026-CHRBS13340
Человек SMOC-1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12026-CMRBS13340
Человек SMOC-1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12026-CYRBS13340
Человек SMOC-1 Джин клон кДНК в вектор клонированияHG12026-GRBS5130
Человек SMOC-1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12026-NFRBS13340
Человек SMOC-1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12026-NHRBS13340
Человек SMOC-1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12026-NMRBS13340
Человек SMOC-1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12026-NYRBS13340
Человек SMOC-1 Джин ORF экспрессии кДНК клона плазмидыHG12026-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

SPARC-related modular calcium-binding protein 1, also known as secreted modular calcium-binding protein 1 and SMOC1, is a member of the SPARC family. SMOC1 is widely expressed in many tissues with a strongest signal in ovary. It contains two EF-hand domains, one Kazal-like domain and two thyroglobulin type-1 domains. Extracellular matrix proteins have been implicated in the regulation of osteoblast differentiation of bone marrow derived mesenchymal stem cells (BMSCs) through paracrine or autocrine mechanisms. SMOC1 is a regulator of osteoblast differentiation of BMSCs. SMOC1 is highly expressed and secreted in BMSCs stimulated with osteogenic medium (OSM). SMOC1 and SMOC2 are matricellular proteins thought to influence growth factor signaling, migration, proliferation, and angiogenesis. SMOC1 and SMOC2 may mediate intercellular signaling and cell type-specific differentiation during gonad and reproductive tract development.

Ссылки
  • Vannahme C. et al., 2002 J. Biol. Chem. 277:37977-86.
  • Pazin,D.E. et al., 2009, Dev Dyn. 238 (11): 2877-90.
  • Choi,Y.A. et al., 2010, J Proteome Res. 9 (6):2946-56.
  • Size / Price
    Каталог: HG12026-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».