Быстрый заказ

Человек SMAC/Diablo transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек DIABLO Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_019887.3
    Размер кДНК:720bp
    Описание кДНК:Full length Clone DNA of Homo sapiens diablo homolog (Drosophila), nuclear gene encoding mitochondrial protein, transcript variant 1 with C terminal Flag tag.
    Синоним гена:SMAC, SMAC3, DIABLO-S, FLJ10537, FLJ25049
    Виды:Human
    переносчик:pCMV3-C-FLAG
    Plasmid:
    Участок рестрикции:
    Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with DIABLO qPCR primers for gene expression analysis, HP100033 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Человек SMAC/Diablo transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
    Человек SMAC/Diablo transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10339-ACGRBS15400
    Человек SMAC/Diablo transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10339-ACRRBS15400
    Человек SMAC/Diablo transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10339-ANGRBS15400
    Человек SMAC/Diablo transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10339-ANRRBS15400
    Человек SMAC/Diablo transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10339-CFRBS13340
    Человек SMAC/Diablo transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10339-CHRBS13340
    Человек SMAC/Diablo transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10339-CMRBS13340
    Человек SMAC/Diablo transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10339-CYRBS13340
    Человек SMAC/Diablo transcript variant 1 Джин клон кДНК в вектор клонированияHG10339-MRBS5130
    Человек SMAC/Diablo transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10339-M-FRBS13340
    Человек SMAC/Diablo transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10339-NFRBS13340
    Человек SMAC/Diablo transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10339-NHRBS13340
    Человек SMAC/Diablo transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10339-NMRBS13340
    Человек SMAC/Diablo transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10339-NYRBS13340
    Человек SMAC/Diablo transcript variant 1 Джин ORF экспрессии кДНК клона плазмидыHG10339-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    Apoptosis is an essential processes required for normal development and homeostasis of all metazoan organisms. Second Mitochondria-Derived Activator of Caspases (Smac) or Direct IAP Binding Protein with low isoelectric point, pI (Diablo) is a proapoptogenic mitochondrial protein that is released to the cytosol in response to diverse apoptotic stimuli, including commonly used chemotherapeutic drugs. The current knowlege about structure and function of Smac/Diablo during programmed cell death, both in mitochondrial and receptor pathways are presented. It has been shown that Diablo mainly interacts with IAPs in the cytochrome c/Apaf-1/caspase-9 pathway, and promotes apoptosis. Diablo is released from the mitochondria into the cytosol occurring downstream of cytochrome c release in response to apoptotic stimuli such as irradiation, DNA damage or cytotoxic drugs. In the cytosol, Smac/Diablo interacts and antagonizes inhibitors of apoptosis proteins (IAPs), thus allowing the activation of caspases and apoptosis. This activity has prompted the synthesis of peptidomimetics that could potentially be used in cancer therapy. The role of Smac/DIABLO in colorectal carcinogenesis is ill defined. Data continues to accumulate to suggest that decreased levels of Smac/DIABLO may be important in chemoradiation-resistance to apoptosis in advanced colon cancer.

    Ссылки
  • Korga A, et al. (2006) Role of mitochondrial protein Smac/Diablo in regulation of apoptotic pathways Pol Merkur Lekarski. 20(119): 573-6.
  • Anguiano-Hernandez YM, et al. (2007) Smac/DIABLO and colon cancer. Anticancer Agents Med Chem. 7(4): 467-73.
  • Martinez-Ruiz G, et al. (2008) Role of Smac/DIABLO in cancer progression. J Exp Clin Cancer Res. 27: 48.
  • Size / Price
    Каталог: HG10339-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».