After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек SLPI Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human SLPI Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_003064.2
Размер кДНК:399bp
Описание кДНК:Full length Clone DNA of Homo sapiens secretory leukocyte peptidase inhibitor with C terminal Flag tag.
Синоним гена:ALP, MPI, ALK1, BLPI, HUSI, WAP4, WFDC4, HUSI-I
Виды:Human
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек SLPI Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек SLPI Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10343-ACGRBS15400
Человек SLPI Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10343-ACRRBS15400
Человек SLPI Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10343-CFRBS13340
Человек SLPI Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10343-CHRBS13340
Человек SLPI Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10343-CMRBS13340
Человек SLPI Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10343-CYRBS13340
Человек SLPI Джин клон кДНК в вектор клонированияHG10343-MRBS5130
Человек SLPI Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10343-M-FRBS13340
Человек SLPI Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10343-M-YRBS13340
Человек SLPI Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10343-NFRBS13340
Человек SLPI Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10343-NHRBS13340
Человек SLPI Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10343-NMRBS13340
Человек SLPI Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10343-NYRBS13340
Человек SLPI Джин ORF экспрессии кДНК клона плазмидыHG10343-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Secretory leukoprotease inhibitor (SLPI), also called antileukoprotease (ALP), is a 12-kDa, nonglycosylated serine protease inhibitor present in mucous secretions. It is thought to play a role in protecting the mucosae from injury associated with inflammation. SLPI is locally produced by serous cells, including bronchial submucosal glands. Elafin and SLPI are members of larger families of proteins secreted predominantly at mucosal sites, and have been shown to be modulated in multiple pathological conditions. Elafin and SLPI are structurally related in that both have a fold with a four-disulfide core or whey acidic protein (WAP) domain responsible for inhibiting proteases. SLPI is a prominent innate immune protein of the respiratory tract, possessing serine protease inhibitor activity, antibacterial activity, and anti-inflammatory/immunomodulatory activity.

Ссылки
  • Moreau T, et al. (2008) Multifaceted roles of human elafin and secretory leukocyte proteinase inhibitor (SLPI), two serine protease inhibitors of the chelonianin family. Biochimie. 90(2): 284-95.
  • Weldon S, et al. (2007) Innate host defense functions of secretory leucoprotease inhibitor. Exp Lung Res. 33(10): 485-91.
  • Williams SE, et al. (2006) SLPI and elafin: one glove, many fingers. Clin Sci (Lond). 110(1): 21-35.
  • Kikuchi T, et al. (1996) Regulation of secretory leukoprotease inhibitor gene expression. Nihon Rinsho. 54(2): 405-10.
  • Size / Price
    Каталог: HG10343-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».