SLITRK6 cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

SLITRK6 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2526 bp
Description
Full length Clone DNA of Human SLIT and NTRK-like family, member 6.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

SLITRK6 cDNA ORF Clone, Human, untagged: Alternative Names

DFNMYP cDNA ORF Clone, Human; SLITRK6 cDNA ORF Clone, Human

SLITRK6 Background Information

SLITRK6 belongs to the SLITRK family. Members of this family share two conserved leucine-rich repeat domains in the extracellular domain. SLITRK6 contains 11 LRR (leucine-rich) repeats, 2 LRRCT domains and 2 LRRNT domains. Expression of SlITRK proteins is highly restricted to neural and brain tumor tissues, but varies within the protein family. SLITRK6 is highly expressed in putamen with no expression in cerebral cortex. It also can be detected in adult and fetal lung and fetal liver. It can suppresse neurite outgrowth. In adult brain, SLITRK6 has a critical role in the development of the inner ear neural circuit.
Full Name
SLIT and NTRK like family member 6
References
  • Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Wiemann S, et al. (2001) Toward a Catalog of Human Genes and Proteins: Sequencing and Analysis of 500 Novel Complete Protein Coding Human cDNAs. Genome Res. 11(3):422-35.
  • Hartley JL, et al. (2001) DNA Cloning Using In Vitro Site-Specific Recombination. Genome Res. 10 (11):1788-95.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait