Быстрый заказ

Человек SLITRK6 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human SLITRK6 Информация о продукте «Клон cDNA»
Размер кДНК:2526bp
Описание кДНК:Full length Clone DNA of Homo sapiens SLIT and NTRK-like family, member 6 with C terminal Flag tag.
Синоним гена:MGC119595, MGC119596, MGC119597, SLITRK6
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек SLITRK6 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек SLITRK6 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13922-ACGRBS22240
Человек SLITRK6 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13922-ACRRBS22240
Человек SLITRK6 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13922-CFRBS20190
Человек SLITRK6 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13922-CHRBS20190
Человек SLITRK6 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13922-CMRBS20190
Человек SLITRK6 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13922-CYRBS20190
Человек SLITRK6 Джин клон кДНК в вектор клонированияHG13922-GRBS5130
Человек SLITRK6 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13922-NFRBS20190
Человек SLITRK6 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13922-NHRBS20190
Человек SLITRK6 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13922-NMRBS20190
Человек SLITRK6 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13922-NYRBS20190
Человек SLITRK6 Джин ORF экспрессии кДНК клона плазмидыHG13922-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name

SLITRK6 belongs to the SLITRK family. Members of this family share two conserved leucine-rich repeat domains in the extracellular domain. SLITRK6 contains 11 LRR (leucine-rich) repeats, 2 LRRCT domains and 2 LRRNT domains. Expression of SlITRK proteins is highly restricted to neural and brain tumor tissues, but varies within the protein family. SLITRK6 is highly expressed in putamen with no expression in cerebral cortex. It also can be detected in adult and fetal lung and fetal liver. It can suppresse neurite outgrowth. In adult brain, SLITRK6 has a critical role in the development of the inner ear neural circuit.

  • Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Wiemann S, et al. (2001) Toward a Catalog of Human Genes and Proteins: Sequencing and Analysis of 500 Novel Complete Protein Coding Human cDNAs. Genome Res. 11(3):422-35.
  • Hartley JL, et al. (2001) DNA Cloning Using In Vitro Site-Specific Recombination. Genome Res. 10 (11):1788-95.
  • Size / Price
    Каталог: HG13922-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.