Быстрый заказ

Человек SLITRK3 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human SLITRK3 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC114621
Размер кДНК:2934bp
Описание кДНК:Full length Clone DNA of Homo sapiens SLIT and NTRK-like family, member 3 with N terminal His tag.
Синоним гена:SLITRK3
Виды:Human
переносчик:pCMV3-SP-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек SLITRK3 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек SLITRK3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15976-ACGRBS22238
Человек SLITRK3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15976-ACRRBS22238
Человек SLITRK3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15976-CFRBS20185
Человек SLITRK3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15976-CHRBS20185
Человек SLITRK3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15976-CMRBS20185
Человек SLITRK3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15976-CYRBS20185
Человек SLITRK3 Джин клон кДНК в вектор клонированияHG15976-GRBS5132
Человек SLITRK3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15976-NFRBS20185
Человек SLITRK3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15976-NHRBS20185
Человек SLITRK3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15976-NMRBS20185
Человек SLITRK3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15976-NYRBS20185
Человек SLITRK3 Джин ORF экспрессии кДНК клона плазмидыHG15976-UTRBS20185
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15976-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».