After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек CD98/SLC3A2/4F2HC Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human SLC3A2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001013251.2
Размер кДНК:1590bp
Описание кДНК:Full length Clone DNA of Homo sapiens solute carrier family 3 (amino acid transporter heavy chain), member 2 with N terminal HA tag.
Синоним гена:4F2, CD98, MDU1, 4F2HC, 4T2HC, NACAE, CD98HC
Виды:Human
переносчик:pCMV3-SP-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек CD98/SLC3A2/4F2HC Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек CD98/SLC3A2/4F2HC Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16415-ACGRBS16760
Человек CD98/SLC3A2/4F2HC Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16415-ACRRBS16760
Человек CD98/SLC3A2/4F2HC Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16415-CFRBS14710
Человек CD98/SLC3A2/4F2HC Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16415-CHRBS14710
Человек CD98/SLC3A2/4F2HC Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16415-CMRBS14710
Человек CD98/SLC3A2/4F2HC Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16415-CYRBS14710
Человек CD98/SLC3A2/4F2HC Джин клон кДНК в вектор клонированияHG16415-GRBS5130
Человек CD98/SLC3A2/4F2HC Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16415-NFRBS14710
Человек CD98/SLC3A2/4F2HC Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16415-NHRBS14710
Человек CD98/SLC3A2/4F2HC Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16415-NMRBS14710
Человек CD98/SLC3A2/4F2HC Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16415-NYRBS14710
Человек CD98/SLC3A2/4F2HC Джин ORF экспрессии кДНК клона плазмидыHG16415-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

4F2 cell-surface antigen heavy chain, also known as 4F2 heavy chain antigen, Lymphocyte activation antigen 4F2 large subunit, CD98, SLC3A2 and MDU1, is a single-pass type I I membrane protein which belongs to the SLC3A transporter family. SLC3A2 / MDU1 is expressed ubiquitously in all tissues tested with highest levels detected in kidney, placenta and testis and weakest level in thymus. During gestation, expression in the placenta is significantly stronger at full-term than at the mid-trimester stage. SLC3A2 / MDU1 is expressed in HUVECS and at low levels in resting peripheral blood T-lymphocytes and quiescent fibroblasts. It is expressed in fetal liver and in the astrocytic process of primary astrocytic gliomas. SLC3A2 / MDU1 is also expressed in retinal endothelial cells and in the intestinal epithelial cell line Caco2-BBE. SLC3A2 / MDU1 is required for the function of light chain amino-acid transporters. It involved in sodium-independent, high-affinity transport of large neutral amino acids such as phenylalanine, tyrosine, leucine, arginine and tryptophan. SLC3A2 / MDU1 is involved in guiding and targeting of LAT1 and LAT2 to the plasma membrane. When associated with SLC7A6 or SLC7A7, SLC3A2 / MDU1 acts as an arginine/glutamine exchanger, following an antiport mechanism for amino acid transport, influencing arginine release in exchange for extracellular amino acids. SLC3A2 / MDU1 plays a role in nitric oxide synthesis in human umbilical vein endothelial cells (HUVECs) via transport of L-arginine. It is required for normal and neoplastic cell growth. When associated with SLC7A5/LAT1, SLC3A2 / MDU1 is also involved in the transport of L-DOPA across the blood-brain barrier, and that of thyroid hormones triiodothyronine (T3) and thyroxine (T4) across the cell membrane in tissues such as placenta.

Ссылки
  • Torrents D. et al., 1998, J Biol Chem. 273: 32437-45.
  • Pfeiffer R. et al., 1999, EMBO J. 18: 49-57.
  • Broeer A. et al., 2000, Biochem J. 349: 787-95.
  • Yanagida O. et al., 2001, Biochim Biophys Acta. 1514: 291-302.
  • Broeer A. et al., 2001, Biochem J. 355: 725-31.
  • Fort J. et al., 2007, J Biol Chem. 282: 31444-52.
  • Mayya V. et al., 2009, Sci Signal. 2: RA46-RA46.
  • Size / Price
    Каталог: HG16415-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».