SLC37A4 cDNA ORF Clone, Human, C-HA tag

Price:
Size:
Number:

SLC37A4 cDNA ORF Clone, Human, C-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1290 bp
Description
Full length Clone DNA of Human solute carrier family 37 (glucose-6-phosphate transporter), member 4 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

SLC37A4 cDNA ORF Clone, Human, C-HA tag: Alternative Names

G6PT1 cDNA ORF Clone, Human; G6PT2 cDNA ORF Clone, Human; G6PT3 cDNA ORF Clone, Human; GSD1b cDNA ORF Clone, Human; GSD1c cDNA ORF Clone, Human; GSD1d cDNA ORF Clone, Human; PRO0685 cDNA ORF Clone, Human; TRG-19 cDNA ORF Clone, Human; TRG19 cDNA ORF Clone, Human

SLC37A4 Background Information

Full Name
solute carrier family 37 (glucose-6-phosphate transporter), member 4
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait