Быстрый заказ

Text Size:AAA

Человек SLC2A4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human SLC2A4 Информация о продукте «Клон cDNA»
Размер кДНК:1530bp
Описание кДНК:Full length Clone DNA of Homo sapiens solute carrier family 2 (facilitated glucose transporter), member 4 with N terminal Myc tag.
Синоним гена:GLUT4, SLC2A4
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек SLC2A4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек SLC2A4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13123-ACGRBS16760
Человек SLC2A4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13123-ACRRBS16760
Человек SLC2A4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13123-CFRBS14710
Человек SLC2A4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13123-CHRBS14710
Человек SLC2A4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13123-CMRBS14710
Человек SLC2A4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13123-CYRBS14710
Человек SLC2A4 Джин клон кДНК в вектор клонированияHG13123-GRBS5130
Человек SLC2A4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13123-NFRBS14710
Человек SLC2A4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13123-NHRBS14710
Человек SLC2A4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13123-NMRBS14710
Человек SLC2A4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13123-NYRBS14710
Человек SLC2A4 Джин ORF экспрессии кДНК клона плазмидыHG13123-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.