After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек SLC2A10 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human SLC2A10 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC113423
Размер кДНК:1626bp
Описание кДНК:Full length Clone DNA of Homo sapiens solute carrier family 2 (facilitated glucose transporter), member 10 with N terminal Flag tag.
Синоним гена:ATS, GLUT10, MGC126706, SLC2A10
Виды:Human
переносчик:pCMV3-SP-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек SLC2A10 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек SLC2A10 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13982-ACGRBS16760
Человек SLC2A10 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13982-ACRRBS16760
Человек SLC2A10 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13982-CFRBS14710
Человек SLC2A10 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13982-CHRBS14710
Человек SLC2A10 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13982-CMRBS14710
Человек SLC2A10 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13982-CYRBS14710
Человек SLC2A10 Джин клон кДНК в вектор клонированияHG13982-GRBS5130
Человек SLC2A10 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13982-NFRBS14710
Человек SLC2A10 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13982-NHRBS14710
Человек SLC2A10 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13982-NMRBS14710
Человек SLC2A10 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13982-NYRBS14710
Человек SLC2A10 Джин ORF экспрессии кДНК клона плазмидыHG13982-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13982-NF
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».