Быстрый заказ

Text Size:AAA

Человек SLC2A1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human SLC2A1 Информация о продукте «Клон cDNA»
Размер кДНК:1479bp
Описание кДНК:Full length Clone DNA of Homo sapiens solute carrier family 2 (facilitated glucose transporter), member 1 with N terminal HA tag.
Синоним гена:DYT18
Участок рестрикции:KpnI + XbaI (6kb + 1.57kb)
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human SLC2A1 Gene Plasmid Map
Human SLC2A1 natural ORF mammalian expression plasmid, N-HA tag
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек SLC2A1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек SLC2A1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12102-ACGRBS15400
Человек SLC2A1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12102-ACRRBS15400
Человек SLC2A1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12102-CFRBS13340
Человек SLC2A1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12102-CHRBS13340
Человек SLC2A1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12102-CMRBS13340
Человек SLC2A1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12102-CYRBS13340
Человек SLC2A1 Джин клон кДНК в вектор клонированияHG12102-GRBS5130
Человек SLC2A1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12102-NFRBS13340
Человек SLC2A1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12102-NHRBS13340
Человек SLC2A1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12102-NMRBS13340
Человек SLC2A1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12102-NYRBS13340
Человек SLC2A1 Джин ORF экспрессии кДНК клона плазмидыHG12102-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG12102-NY
Цена по прейскуранту: 
Цена:      (You Save: )
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
Contact Us
  • Human SLC2A1 natural ORF mammalian expression plasmid, N-HA tag
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.