FATP2 cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

FATP2 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1863 bp
Description
Full length Clone DNA of Human solute carrier family 27 (fatty acid transporter), member 2.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

FATP2 cDNA ORF Clone, Human, untagged: Alternative Names

ACSVL1 cDNA ORF Clone, Human; FACVL1 cDNA ORF Clone, Human; FATP2 cDNA ORF Clone, Human; hFACVL1 cDNA ORF Clone, Human; HsT17226 cDNA ORF Clone, Human; VLACS cDNA ORF Clone, Human; VLCS cDNA ORF Clone, Human

FATP2 Background Information

Full Name
solute carrier family 27 (fatty acid transporter), member 2
Research Areas
Add to Cart Successfully Add to Cart Failed