After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек SLC25A11 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human SLC25A11 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_003562.4
Размер кДНК:945bp
Описание кДНК:Full length Clone DNA of Homo sapiens solute carrier family 25 (mitochondrial carrier; oxoglutarate carrier), member 11.
Синоним гена:OGC, SLC20A4
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек SLC25A11 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек SLC25A11 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16162-ACGRBS15400
Человек SLC25A11 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16162-ACRRBS15400
Человек SLC25A11 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG16162-ANGRBS15400
Человек SLC25A11 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG16162-ANRRBS15400
Человек SLC25A11 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16162-CFRBS13340
Человек SLC25A11 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16162-CHRBS13340
Человек SLC25A11 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16162-CMRBS13340
Человек SLC25A11 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16162-CYRBS13340
Человек SLC25A11 Джин клон кДНК в вектор клонированияHG16162-GRBS5130
Человек SLC25A11 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16162-NFRBS13340
Человек SLC25A11 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16162-NHRBS13340
Человек SLC25A11 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16162-NMRBS13340
Человек SLC25A11 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16162-NYRBS13340
Человек SLC25A11 Джин ORF экспрессии кДНК клона плазмидыHG16162-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG16162-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».