SLAMF8 cDNA ORF Clone, Human, C-His tag

1/1
Price:
Size:
Number:

SLAMF8 cDNA ORF Clone, Human, C-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
903 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human SLAM family member 8 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+0.9kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

SLAMF8 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SLAMF8 cDNA ORF Clone, Human, C-His tag: Validated Images

SLAMF8 cDNA ORF Clone, Human, C-His tag: Alternative Names

BLAME cDNA ORF Clone, Human; CD353 cDNA ORF Clone, Human; SBBI42 cDNA ORF Clone, Human

SLAMF8 Background Information

The signaling lymphocyte activation molecule (SLAM) family includes homophilic and heterophilic receptors that modulate both adaptive and innate immune responses. These receptors share a common ectodomain organization: a membrane-proximal immunoglobulin constant domain and a membrane-distal immunoglobulin variable domain that is responsible for ligand recognition. SLAM family of receptors is expressed by a wide range of immune cells. Through their cytoplasmic domain, SLAM family receptors associate with SLAM-associated protein (SAP)-related molecules, a group of cytoplasmic adaptors composed almost exclusively of an SRC homology 2 domain. SLAM family receptors, in association with SAP family adaptors, have crucial roles during normal immune reactions in innate and adaptive immune cells.
Mouse SLAM family member 8, also known as B-lymphocyte activator macrophage expressed, BCM-like membrane protein, SLAMF8 and BLAME, is a single-pass type I membrane protein. It contains oneIg-like C2-type (immunoglobulin-like) domain. SLAMF8 / BLAME is expressed in lymph node, spleen, thymus and bone marrow. It may play a role in B-lineage commitment and/or modulation of signaling through the B-cell receptor.
Full Name
SLAM family member 8
References
  • Kingsbury G.A., et al., 2001, J. Immunol. 166:5675-80.
  • Zhang Z., et al., 2004, Protein Sci. 13: 2819-24.
  • Veillette,A. et al., 2006, Nat Rev Immunol  6 (1): 56-66.
  • Veillette,A. et al., 2006, Trends Immunol  27 (5): 228-34.
  • Yan,Q. et al., 2007, Proc Natl Acad Sci. USA.104 (25):10583-8.
Add to Cart Successfully Add to Cart Failed 正在更新购物车,请稍后