After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек SLAMF8 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human SLAMF8 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_020125.2
Размер кДНК:858bp
Описание кДНК:Full length Clone DNA of Homo sapiens SLAM family member 8 with C terminal His tag.
Синоним гена:BLAME, SBBI42, FLJ20442, MGC129578
Виды:Human
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек SLAMF8 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек SLAMF8 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11101-ACGRBS15400
Человек SLAMF8 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11101-ACRRBS15400
Человек SLAMF8 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11101-CFRBS13340
Человек SLAMF8 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11101-CHRBS13340
Человек SLAMF8 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11101-CMRBS13340
Человек SLAMF8 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11101-CYRBS13340
Человек SLAMF8 Джин клон кДНК в вектор клонированияHG11101-MRBS5130
Человек SLAMF8 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11101-M-FRBS13340
Человек SLAMF8 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11101-NFRBS13340
Человек SLAMF8 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11101-NHRBS13340
Человек SLAMF8 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11101-NMRBS13340
Человек SLAMF8 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11101-NYRBS13340
Человек SLAMF8 Джин ORF экспрессии кДНК клона плазмидыHG11101-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

The signaling lymphocyte activation molecule (SLAM) family includes homophilic and heterophilic receptors that modulate both adaptive and innate immune responses. These receptors share a common ectodomain organization: a membrane-proximal immunoglobulin constant domain and a membrane-distal immunoglobulin variable domain that is responsible for ligand recognition. SLAM family of receptors is expressed by a wide range of immune cells. Through their cytoplasmic domain, SLAM family receptors associate with SLAM-associated protein (SAP)-related molecules, a group of cytoplasmic adaptors composed almost exclusively of an SRC homology 2 domain. SLAM family receptors, in association with SAP family adaptors, have crucial roles during normal immune reactions in innate and adaptive immune cells.
Mouse SLAM family member 8, also known as B-lymphocyte activator macrophage expressed, BCM-like membrane protein, SLAMF8 and BLAME, is a single-pass type I  membrane protein. It contains one Ig-like C2-type (immunoglobulin-like) domain. SLAMF8 / BLAME is expressed in lymph node, spleen, thymus and bone marrow. It may play a role in B-lineage commitment and/or modulation of signaling through the B-cell receptor.

Ссылки
  • Kingsbury G.A., et al., 2001, J. Immunol. 166:5675-80.
  • Zhang Z., et al., 2004, Protein Sci. 13: 2819-24.
  • Veillette,A. et al., 2006, Nat Rev Immunol  6 (1): 56-66.
  • Veillette,A. et al., 2006, Trends Immunol  27 (5): 228-34.
  • Yan,Q. et al., 2007, Proc Natl Acad Sci. USA.104 (25):10583-8.
  • Size / Price
    Каталог: HG11101-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».