Быстрый заказ

Человек SLAMF8 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human SLAMF8 Информация о продукте «Клон cDNA»
Размер кДНК:858bp
Описание кДНК:Full length Clone DNA of Homo sapiens SLAM family member 8 with C terminal His tag.
Синоним гена:BLAME, SBBI42, FLJ20442, MGC129578
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек SLAMF8 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек SLAMF8 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11101-ACGRBS15400
Человек SLAMF8 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11101-ACRRBS15400
Человек SLAMF8 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11101-CFRBS13340
Человек SLAMF8 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11101-CHRBS13340
Человек SLAMF8 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11101-CMRBS13340
Человек SLAMF8 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11101-CYRBS13340
Человек SLAMF8 Джин клон кДНК в вектор клонированияHG11101-MRBS5130
Человек SLAMF8 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11101-M-FRBS13340
Человек SLAMF8 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11101-NFRBS13340
Человек SLAMF8 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11101-NHRBS13340
Человек SLAMF8 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11101-NMRBS13340
Человек SLAMF8 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11101-NYRBS13340
Человек SLAMF8 Джин ORF экспрессии кДНК клона плазмидыHG11101-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

The signaling lymphocyte activation molecule (SLAM) family includes homophilic and heterophilic receptors that modulate both adaptive and innate immune responses. These receptors share a common ectodomain organization: a membrane-proximal immunoglobulin constant domain and a membrane-distal immunoglobulin variable domain that is responsible for ligand recognition. SLAM family of receptors is expressed by a wide range of immune cells. Through their cytoplasmic domain, SLAM family receptors associate with SLAM-associated protein (SAP)-related molecules, a group of cytoplasmic adaptors composed almost exclusively of an SRC homology 2 domain. SLAM family receptors, in association with SAP family adaptors, have crucial roles during normal immune reactions in innate and adaptive immune cells.
Mouse SLAM family member 8, also known as B-lymphocyte activator macrophage expressed, BCM-like membrane protein, SLAMF8 and BLAME, is a single-pass type I  membrane protein. It contains one Ig-like C2-type (immunoglobulin-like) domain. SLAMF8 / BLAME is expressed in lymph node, spleen, thymus and bone marrow. It may play a role in B-lineage commitment and/or modulation of signaling through the B-cell receptor.

  • Kingsbury G.A., et al., 2001, J. Immunol. 166:5675-80.
  • Zhang Z., et al., 2004, Protein Sci. 13: 2819-24.
  • Veillette,A. et al., 2006, Nat Rev Immunol  6 (1): 56-66.
  • Veillette,A. et al., 2006, Trends Immunol  27 (5): 228-34.
  • Yan,Q. et al., 2007, Proc Natl Acad Sci. USA.104 (25):10583-8.
  • Size / Price
    Каталог: HG11101-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.