Быстрый заказ

Человек SLAMF8 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек SLAMF8 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_020125.2
    Размер кДНК:858bp
    Описание кДНК:Full length Clone DNA of Homo sapiens SLAM family member 8 with C terminal His tag.
    Синоним гена:BLAME, SBBI42, FLJ20442, MGC129578
    Виды:Human
    переносчик:pCMV3-C-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with SLAMF8 qPCR primers for gene expression analysis, HP101016 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Человек SLAMF8 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Человек SLAMF8 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11101-ACGRBS15400
    Человек SLAMF8 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11101-ACRRBS15400
    Человек SLAMF8 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11101-CFRBS13340
    Человек SLAMF8 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11101-CHRBS13340
    Человек SLAMF8 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11101-CMRBS13340
    Человек SLAMF8 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11101-CYRBS13340
    Человек SLAMF8 Джин клон кДНК в вектор клонированияHG11101-MRBS5130
    Человек SLAMF8 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11101-M-FRBS13340
    Человек SLAMF8 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11101-NFRBS13340
    Человек SLAMF8 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11101-NHRBS13340
    Человек SLAMF8 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11101-NMRBS13340
    Человек SLAMF8 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11101-NYRBS13340
    Человек SLAMF8 Джин ORF экспрессии кДНК клона плазмидыHG11101-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    The signaling lymphocyte activation molecule (SLAM) family includes homophilic and heterophilic receptors that modulate both adaptive and innate immune responses. These receptors share a common ectodomain organization: a membrane-proximal immunoglobulin constant domain and a membrane-distal immunoglobulin variable domain that is responsible for ligand recognition. SLAM family of receptors is expressed by a wide range of immune cells. Through their cytoplasmic domain, SLAM family receptors associate with SLAM-associated protein (SAP)-related molecules, a group of cytoplasmic adaptors composed almost exclusively of an SRC homology 2 domain. SLAM family receptors, in association with SAP family adaptors, have crucial roles during normal immune reactions in innate and adaptive immune cells.
    Mouse SLAM family member 8, also known as B-lymphocyte activator macrophage expressed, BCM-like membrane protein, SLAMF8 and BLAME, is a single-pass type I  membrane protein. It contains one Ig-like C2-type (immunoglobulin-like) domain. SLAMF8 / BLAME is expressed in lymph node, spleen, thymus and bone marrow. It may play a role in B-lineage commitment and/or modulation of signaling through the B-cell receptor.

    Ссылки
  • Kingsbury G.A., et al., 2001, J. Immunol. 166:5675-80.
  • Zhang Z., et al., 2004, Protein Sci. 13: 2819-24.
  • Veillette,A. et al., 2006, Nat Rev Immunol  6 (1): 56-66.
  • Veillette,A. et al., 2006, Trends Immunol  27 (5): 228-34.
  • Yan,Q. et al., 2007, Proc Natl Acad Sci. USA.104 (25):10583-8.
  • Size / Price
    Каталог: HG11101-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».