Быстрый заказ

Человек SIRT7 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human SIRT7 Информация о продукте «Клон cDNA»
Размер кДНК:1203bp
Описание кДНК:Full length Clone DNA of Homo sapiens sirtuin 7 with N terminal His tag.
Синоним гена:SIR2L7, SIRT7
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек SIRT7 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек SIRT7 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12304-ACGRBS15396
Человек SIRT7 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12304-ACRRBS15400
Человек SIRT7 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12304-ANGRBS15396
Человек SIRT7 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12304-ANRRBS15400
Человек SIRT7 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12304-CFRBS13343
Человек SIRT7 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12304-CHRBS13343
Человек SIRT7 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12304-CMRBS13343
Человек SIRT7 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12304-CYRBS13343
Человек SIRT7 Джин клон кДНК в вектор клонированияHG12304-GRBS5132
Человек SIRT7 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12304-NFRBS13343
Человек SIRT7 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12304-NHRBS13343
Человек SIRT7 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12304-NMRBS13343
Человек SIRT7 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12304-NYRBS13343
Человек SIRT7 Джин ORF экспрессии кДНК клона плазмидыHG12304-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG12304-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие4-5 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.